Testing

What kind of Covid tests are commonly used?

Both in vitro diagnostics, the tests are genesig Real-Time PCR Coronavirus (COVID‑19) and cobas SARS‑CoV‑2 Qualitative assay for use on the cobas® 6800/8800 Systems.
—WHO, WHO lists two COVID‑19 tests for emergency use
The test kit is called the “Centers for Disease Control and Prevention (CDC) 2019-Novel Coronavirus (2019-nCoV) Real-Time Reverse Transcriptase (RT)-PCR Diagnostic Panel.”
—CDC, CDC Diagnostic Test for COVID‑19

What warning did Kary Mullis, the inventor of the PCR test, give about the PCR test?

…with PCR, if you do it well, you can find almost anything in anybody.
PCR is just a process that allows you to make a whole lot of something out of something. It doesn’t tell you that you’re sick, or that the thing that you ended up with was going to hurt you or anything like that.
—Kary Mullis, Corporate Greed And Aids Santa Monica 12 July 1997
If you have to go more than 40 cycles to amplify a single-copy gene, there is something seriously wrong with your PCR.
PCR Protocols: A Guide to Methods and Applications, pages 8–9

Are PCR tests binary true/false or are they on a sliding scale?

The way they have been reporting from the State and else where is either “yes” or “no,” but in reality, it comes in what is called cycle-thresholds. It’s an inverse relationship, so the higher the number the less virus there was in the initial sample. And so, some labs will report out to 40 cycle-thresholds, and if they get a positive at 40—which means there is a tiny, tiny, tiny amount of virus there—that gets reported to us as positive, and we don’t know any different. Other labs have a cutoff at like 34–35.
—Dr. David Persee (Houston Health Department Health Authority), Derrick Broze Interview (5:58–6:54)

Have PCR tests been known to give false positives for other viruses?

[S]everal false positives for the AI virus were detected in samples from specific wild bird species when the reverse transcription (RT)-PCR technique
—Núria Busquets Martí, et al., False-Positive Results Obtained by Following a Commonly Used Reverse Transcription-PCR Protocol for Detection of Influenza A Virus

Do Covid‑19 tests give different results when multiple tests are preformed?

In the first test for all patients, 168 cases were positive (27.5%), one was weakly positive (0.2%), 57 were dubious positive (9.3%), and 384 were negative (63.0%)….
Among the 384 patients with initial negative results, the second test was performed. For these patients, the test results were positive in 48 cases (12.5%), dubiously positive in 27 patients (7.0%), negative in 280 patients (72.9%)….
—Yafang Li, et al., Stability issues of RT‐PCR testing of SARS‐CoV‐2 for hospitalized patients clinically diagnosed with COVID‐19
As the prevention and control of COVID‑19 continues to advance, the active nucleic acid test screening in the close contacts of the patients has been carrying out in many parts of China. However, the false-positive rate of positive results in the screening has not been reported up to now.

[…]
…the false-positive rate of positive results was 80.33%….
—G H Zhuang, et al., Potential False-Positive Rate Among the ‘Asymptomatic Infected Individuals’ in Close Contacts of COVID‑19 Patients

What does the FDA claim about the reliability of the tests?

Negative results from pooled testing should not be treated as definitive.

[…]
Negative results do not preclude SARS‑CoV‑2 infection and should not be used as the sole basis for treatment….

[…]
A false negative result may occur if a specimen is improperly collected, transported or handled. False negative results may also occur if amplification inhibitors are present in the specimen or if inadequate numbers of organisms are present in the specimen. Positive and negative predictive values are highly dependent on prevalence. False negative test results are more likely when prevalence of disease is high. False positive test results are more likely when prevalence is moderate to low.

[…]
Inhibitors or other types of interference may produce a false negative result.
—FDA, SARS‑CoV‑2 RNA, Qualitative Real-Time RT-PCR Package Insert

If over 40 cycles is considered far too many by the inventor of the PCR test, what is considered a good PCR cycle threshold (Ct) value?

The SARS‑CoV‑2 RT-qPCR test provides real-time quantification by first reverse transcribing SARS‑CoV‑2 RNA into DNA (RT step), and then performing qPCR, during which a fluorescence signal increases proportionally to the amount of amplified nucleic acid, enabling accurate quantitation of the RNA in the sample. If the fluorescence reaches a specified threshold within a certain number of PCR cycles (Ct value), the sample is considered a positive result. The Ct value is inversely related to the viral load and every ~3.3 increase in the Ct value reflects a 10-fold reduction in starting material. Many qPCR assays involve a Ct cutoff of 40 to consider the test positive, allowing detection of very few starting RNA molecules.

[…]
We propose that for inpatients whose symptoms have fully resolved and 2 tests over 24 hours apart are either negative or close to the Ct cutoff (ie, Ct >34), they likely do not have meaningful or transmissible disease, and thus do not need to be retested.
—Michael R Tom, Michael J Mina, To Interpret the SARS‑CoV‑2 Test, Consider the Cycle Threshold Value
Any test with a cycle threshold above 35 is too sensitive, agreed Juliet Morrison, a virologist at the University of California, Riverside. “I’m shocked that people would think that 40 could represent a positive,” she said.
A more reasonable cutoff would be 30 to 35, she added. Dr. Mina said he would set the figure at 30, or even less.

[…]
The C.D.C.’s own calculations suggest that it is extremely difficult to detect any live virus in a sample above a threshold of 33 cycles [see Figure 5]. Officials at some state labs said the C.D.C. had not asked them to note threshold values or to share them with contact-tracing organizations.
New York Times, Your Coronavirus Test Is Positive. Maybe It Shouldn’t Be.

How many PCR cycles are being used?

All clinical samples should exhibit fluorescence growth curves in the RNase P reaction that cross the threshold line within 40.00 cycles (< 40.00 Ct).
—CDC/FDA, CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel
The cycling conditions are as follows: 25 °C (2 minutes), 50 °C (15 minutes), and 95 °C (2 minutes), then amplification for 40 cycles (95 °C 3 seconds, 55 °C 30 seconds) with fluorescence measured at 55 °C.
—Jeffrey A SoRelle, et al., Clinical Validation of a SARS‑CoV‑2 Real-Time Reverse Transcription PCR Assay Targeting the Nucleocapsid Gene
Thermal cycling was performed at 55°C for 10 min for reverse transcription, followed by 95°C for 3 min and then 45 cycles of 95°C for 15 s, 58°C for 30 s.
—WHO, Diagnostic detection of 2019-nCoV by real-time RT-PCR
The following one-step PCR protocol was used: one cycle at 45°C for 10 minutes and 95°C for 3 minutes, followed by 45 cycles at 95°C for 15 seconds and 58°C for 30 seconds, with single-point fluorescence detection at 58°C.
—Yingping Wu, et al., Laboratory verification of an RT-PCR assay for SARS‑CoV‑2
Amplification…x50
—WHO, Protocol: Real-time RT-PCR assays for the detection of SARS‑CoV‑2
Target amplification was performed in 55 cycles of 94◦C for 15 seconds, 48◦C for 30 seconds, 68◦C for 1 minute, and a final extension at 68◦C for 5 minutes.
—Young BE, Ong SWX, Kalimuddin S, et al., Epidemiologic Features and Clinical Course of Patients Infected With SARS‑CoV‑2 in Singapore. JAMA. 2020;323(15):1488–1494. doi:10.1001/jama.2020.3204 (Supplementary Online Content)

Are people being reported as positive without being tested?

Many people are claiming to have been declared Covid‑19 positive, even without taking a test (including some people I know).
Examples:
State confirms 300 people incorrectly traced as positive COVID 19 cases.
Concerns arise as some receive positive COVID‑19 results but never got tested.
Mt. Juliet man says even with no test, he’s informed he is COVID‑19 positive by state.
A nurse from New York claims that even after testing negative, some people are still marked as positive. (4:07–5:55)

What genetic sequences are the PCR tests searching for?

nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG
nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT
nCoV_IP2-12696bProbe(+) AGATGTCTTGTGCTGCCGGTA
nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG
nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG
nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG
—WHO, Protocol: Real-time RT-PCR assays for the detection of SARS‑CoV‑2

Are any of those genetic sequences found naturally occurring in the human genome, and therefore would likely cause false-positive results?

FEATURES             Location/Qualifiers
     source          1..18
                     /organism="Homo sapiens"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
ORIGIN
        1 ctccctttgt tgtgttgt
—National Center for Biotechnology, Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly, NCBI Reference Sequence: NC_000008.11

Questions to ask? Comments to add?
Send an email to nathan@legionsletters.com.